BioRubyOnRails

From BioRuby

Jump to: navigation, search

This page describes how to use BioRuby with your Rails application.

BioRuby comes with an interactive shell which can be used in a console or in a web browser as a Rails plugin.

Image:Bioruby_shell_on_rails.png

How to use BioRuby on Rails

Installing the BioRuby 1.3.0 release as a Ruby gems package.

% sudo gem install bio
Password:
Successfully installed bio-1.3.0
1 gem installed
Installing ri documentation for bio-1.3.0...
Installing RDoc documentation for bio-1.3.0...

If your gem stick at the following message

Bulk updating Gem source index for: http://gems.rubyforge.org

and took very long time to find the BioRuby gem, you'd better to update the RubyGems itself.

% gem -v
1.0.1
 
% sudo gem update --system
Updating RubyGems...
Bulk updating Gem source index for: http://gems.rubyforge.org
Attempting remote update of rubygems-update
Successfully installed rubygems-update-1.3.1
1 gem installed
Updating version of RubyGems to 1.3.1
Installing RubyGems 1.3.1
 :
RubyGems system software updated
 
% gem -v
1.3.1

OK. Test the BioRuby shell in a console.

% bioruby
Loading config (/Users/xxx/.bioruby/shell/session/config) ... done
Loading object (/Users/xxx/.bioruby/shell/session/object) ... done
Loading history (/Users/xxx/.bioruby/shell/session/history) ... done
 
. . . B i o R u b y   i n   t h e   s h e l l . . .
 
  Version : BioRuby 1.3.0 / Ruby 1.8.6
 
bioruby> seq = getseq("atgc" * 10)
  ==> #<Bio::Sequence:0x117de40 @seq="atgcatgcatgcatgcatgcatgcatgcatgcatgcatgc", @moltype=Bio::Sequence::NA>
bioruby> seq.randomize
  ==> "ttcgagaacaccgcgatcgttgcaagattcgttatcaggc"
bioruby> seq.randomize.translate
  ==> "HFGLYRN*RGQRL"
bioruby> exit
 
 
. . . B i o R u b y   i n   t h e   s h e l l . . .
 
Saving history (/Users/full/.bioruby/shell/session/history) ... done
Saving object (/Users/full/.bioruby/shell/session/object) ... done
Saving config (/Users/full/.bioruby/shell/session/config) ... done

Create an Rails project (you can also use existing Rails application as well).

% rails -v
Rails 1.2.6
 
% rails hoge
      create  
      create  app/controllers
        :
      create  log/test.log

Activate the BioRuby shell as a Rails plugin.

% bioruby --rails hoge
Creating directory (/Users/ktym/hoge/shell/session) ... done
Creating directory (/Users/ktym/hoge/shell/plugin) ... done
Creating directory (/Users/ktym/hoge/data) ... done
Installing Rails plugin for BioRuby shell ... 
      exists  app/controllers
      exists  app/helpers
      create  app/views/bioruby
      exists  app/views/layouts
      create  public/images/bioruby
      exists  public/stylesheets
      create  app/controllers/bioruby_controller.rb
      create  app/helpers/bioruby_helper.rb
      create  app/views/bioruby/_methods.rhtml
      create  app/views/bioruby/_classes.rhtml
      create  app/views/bioruby/_modules.rhtml
      create  app/views/bioruby/_log.rhtml
      create  app/views/bioruby/_variables.rhtml
      create  app/views/bioruby/commands.rhtml
      create  app/views/bioruby/history.rhtml
      create  app/views/bioruby/index.rhtml
      create  app/views/layouts/bioruby.rhtml
      create  public/images/bioruby/spinner.gif
      create  public/images/bioruby/gem.png
      create  public/images/bioruby/link.gif
      create  public/images/bioruby/bg.gif
      create  public/stylesheets/bioruby.css
done
 
>>>
>>>  open http://localhost:3000/bioruby
>>>
 
(You can change the port number by adding "-- -p 4000" option)
 
 
. . . B i o R u b y   i n   t h e   s h e l l . . .
 
  Version : BioRuby 1.3.0 / Ruby 1.8.7
 
=> Booting WEBrick...
=> Rails application started on http://0.0.0.0:3000
=> Ctrl-C to shutdown server; call with --help for options
[2009-02-25 01:19:29] INFO  WEBrick 1.3.1
[2009-02-25 01:19:29] INFO  ruby 1.8.7 (2008-06-09) [i686-darwin9.3.0]
[2009-02-25 01:19:29] INFO  WEBrick::HTTPServer#start: pid=11036 port=3000

You may see the different message as follows if you have installed a Mongrel web server for Rails.

. . . B i o R u b y   i n   t h e   s h e l l . . .
 
  Version : BioRuby 1.3.0 / Ruby 1.8.6
 
./config/boot.rb:20:Warning: Gem::SourceIndex#search support for String patterns is deprecated
=> Booting Mongrel (use 'script/server webrick' to force WEBrick)
=> Rails application starting on http://0.0.0.0:3000
=> Call with -d to detach
=> Ctrl-C to shutdown server
/Library/Ruby/Gems/1.8/gems/mongrel-1.1.5/bin/mongrel_rails:60: warning: conflicting chdir during another chdir block
** Starting Mongrel listening at 0.0.0.0:3000
** Starting Rails with development environment...
** Rails loaded.
** Loading any Rails specific GemPlugins
** Signals ready.  TERM => stop.  USR2 => restart.  INT => stop (no restart).
** Rails signals registered.  HUP => reload (without restart).  It might not work well.
** Mongrel 1.1.5 available at 0.0.0.0:3000
** Use CTRL-C to stop.

Anyway, that's it. You are ready to use the BioRuby shell on Rails now.

Open the following URL in your web browser.

http://localhost:3000/bioruby

You can now able to use all of Ruby and BioRuby functionalities even with your Rails models in your browser. Enjoy!

Personal tools